zgc:136572

Ensembl ID:
ENSDARG00000092332
ZFIN ID:
ZDB-GENE-060616-231
Description:
glutamate [Source:RefSeq peptide;Acc:NP_001038775]
Human Orthologue:
GRINA
Human Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) [Sourc
Mouse Orthologue:
Grina
Mouse Description:
glutamate receptor, ionotropic, N-methyl D-aspartate-associated protein 1 (glutamate binding) Gene [

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23602 Nonsense Available for shipment Available now
sa1380 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23602
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034302 Nonsense 103 363 2 7
Genomic Location (Zv9):
Chromosome 19 (position 48348963)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46688643
GRCz11 19 46280898
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATACCCGCAAGCGAACTACGCTCAAGGGCCGTACCCTCAGAGCCCATAC[C/T]AGCAGGGGCCCGGCCAGCCCGCCTTCGGTGTAGATCCTAATGGTAAGTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1380
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034302 Essential Splice Site 224 363 5 7
Genomic Location (Zv9):
Chromosome 19 (position 48338825)
Other Location(s):
Assembly Chromosome Position
GRCz10 19 46698781
GRCz11 19 46291036
KASP Assay ID:
554-1292.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATATTTTATTTTGGATGTTTAATTTCTATCTTTTTCTCTCTCTTTCTCA[G/A]TCCATCCTGACTCTGAGTCTGTCCTATTTGGTTGGCATGATTGCCAGCTT
Associated Phenotype:

Normal

Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link