vtg1

Ensembl ID:
ENSDARG00000092233
ZFIN ID:
ZDB-GENE-001201-1
Description:
vitellogenin 1 [Source:RefSeq peptide;Acc:NP_001038362]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa5972 Nonsense Mutation detected in F1 DNA During 2018
sa37522 Nonsense Mutation detected in F1 DNA During 2018
sa37521 Nonsense Available for shipment Available now
sa39374 Nonsense Mutation detected in F1 DNA During 2018
sa12457 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa5972
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050238 Nonsense 534 1362 12 28
ENSDART00000078276   None 322 None 10

The following transcripts of ENSDARG00000092233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25208070)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24707976
GRCz11 22 24735600
KASP Assay ID:
554-3761.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTATGCATGTTTTCTTCCAATKAAAAAAACTTTGTTTCCTGTATCAGGTT[C/T]AGCCTGTTGCCCTGCAGCTTGTTTTGGACAGAGCTCTCCACCCMGAGGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37522
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050238 Nonsense 635 1362 13 28
ENSDART00000078276   None 322 None 10

The following transcripts of ENSDARG00000092233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25207650)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24707556
GRCz11 22 24735180
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACTGGACAGACTTAACTACCGTTACAGCAGAGCTTTTCAGATGGACTA[T/G]TATTATAGTAAGAATTTCTAATTTCTTAAGAGCTAAGAAATTATATCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37521
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050238 Nonsense 708 1362 15 28
ENSDART00000078276   None 322 None 10

The following transcripts of ENSDARG00000092233 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25207215)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24707121
GRCz11 22 24734745
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCTAAAATCTCCTGCTGCAGATGAAAGTGCTGACCGTATCACAAAGATT[A/T]AGCGTACACTGAGAGCAGTAAGTTTTTTTTATGTCCATAGTATCTTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39374
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050238 Nonsense 1073 1362 22 28
ENSDART00000078276   None 322 None 10

The following transcripts of ENSDARG00000092233 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25205482)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24705388
GRCz11 22 24733012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTGAGGGAAATCCTGGACACTGAAGCTAAAAATGCACCTGTTTCTTCT[G/T]AAAGCAGCAGCAGTCGTAACAGTCGCAGCAGCAGCAGCCGCAGCACCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12457
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050238 Nonsense 1154 1362 24 28
ENSDART00000078276 Nonsense 114 322 6 10

The following transcripts of ENSDARG00000092233 do not overlap with this mutation:

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25204708)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24704614
GRCz11 22 24732238
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATAGCGCCACAAAGGATACTAGCAGTGGAAGTGCTGSAGCTAGCTTTGAR[C/T]AAATGCAGAAACAGGTTAGTCTCAGCTATTTGCCCMTGAAGCAAACCCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link