si:dkey-3h2.3

Ensembl ID:
ENSDARG00000092144
ZFIN ID:
ZDB-GENE-070705-465
Description:
Novel protein with a NACHT domain [Source:UniProtKB/TrEMBL;Acc:A5PMW5]
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa37536 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa37536
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000139396 Nonsense 48 759 2 6
Genomic Location (Zv9):
Chromosome 22 (position 29827149)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 68236932
GRCz11 4 70263154
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGCTCTAAAGGTGATCCTCCTCCAAGCTTCAGTGAGAAAACACCATCAT[C/A]AGTTAAAAGGTATTTAGTGTTTTACATTATTGAACACACTTGGACTGTAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link