vtg5

Ensembl ID:
ENSDARG00000092126
ZFIN ID:
ZDB-GENE-001201-4
Description:
vitellogenin 5 [Source:RefSeq peptide;Acc:NP_001020360]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43853 Nonsense Mutation detected in F1 DNA During 2018
sa24180 Essential Splice Site Available for shipment Available now
sa24179 Nonsense Available for shipment Available now
sa24178 Nonsense Available for shipment Available now
sa29792 Nonsense Mutation detected in F1 DNA During 2018
sa7496 Missense Mutation detected in F1 DNA During 2018
sa39375 Essential Splice Site Mutation detected in F1 DNA During 2018
sa29791 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43853
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Nonsense 78 1358 4 28
ENSDART00000078225 Nonsense 83 1363 4 28
ENSDART00000129486   None 246 4 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25229715)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24729621
GRCz11 22 24757245
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTTTTTTAAATGCTAATATCCCCTTACAGCTTATGGATCCTCTACTCTA[C/A]GAGTATGCTGGCACTTGGCCCAGAGATCCATTTGTTCCTGCCACTAAGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24180
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Essential Splice Site 259 1358 6 28
ENSDART00000078225 Essential Splice Site 264 1363 6 28
ENSDART00000129486   None 246 None 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25228981)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24728887
GRCz11 22 24756511
KASP Assay ID:
2261-6888.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTCTCACCCTTTAATGAGATCCATGGTGCTGCAATGATGGAAGCAAAG[T/A]ATGATTGAGCAATCATTGAGATTTCAGTTATAATTGTTTAACAATATTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24179
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Nonsense 588 1358 12 28
ENSDART00000078225 Nonsense 593 1363 12 28
ENSDART00000129486   None 246 None 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25227458)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24727364
GRCz11 22 24754988
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGGAGCATTGAGGACTGAGCCAAACATGCATGTCTCAAGCTTTGCCTA[T/A]TCCCACATCAAGTCCTTGACCAGAATCACTGCTCCTGATATGGCATCTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24178
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Nonsense 838 1358 18 28
ENSDART00000078225 Nonsense 843 1363 18 28
ENSDART00000129486   None 246 None 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25226118)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24726024
GRCz11 22 24753648
KASP Assay ID:
2261-6886.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACCTGCTCTCCCTGAGAAATTGGAGTCCATGACTTATGAGCAACTAAAG[A/T]AGACTGATGTTCAGTTCCAAGCTGAAGCTAGACCAAGGTACAGTTTTACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29792
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Nonsense 882 1358 19 28
ENSDART00000078225 Nonsense 887 1363 19 28
ENSDART00000129486   None 246 None 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25225897)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24725803
GRCz11 22 24753427
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCATCCAAGCTGCTGTTATGGCAAGAGGAAAGATCCGTACAATTGCCCCC[G/T]GAAAAGTGGCAGCAAGAGCAGACATTCTCAAGGGCAACTACAAGGTGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7496
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Missense 1129 1358 23 28
ENSDART00000078225 Missense 1134 1363 23 28
ENSDART00000129486 Missense 17 246 6 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25224793)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24724699
GRCz11 22 24752323
KASP Assay ID:
554-4334.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGATTTTCAGACTGCCACCATCATAGAGCCTTTCAGAAAATTCCACAAAG[A/T]TCGGGTAAACATTAAATAATCTTTTGATACTTTAATTGTACTTAATTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39375
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Essential Splice Site 1157 1358 None 28
ENSDART00000078225 Essential Splice Site 1162 1363 None 28
ENSDART00000129486 Essential Splice Site 45 246 None 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25224550)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24724456
GRCz11 22 24752080
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAAACCTAAAATATGATGTAGTTCCAATTTTTGTTTTGTTTTATCCTTTC[A/T]GAATAGATTCCTTGGAAATGATATTCCACCTGTTTTTGCTATCATCGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29791
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000061223 Essential Splice Site 1225 1358 25 28
ENSDART00000078225 Essential Splice Site 1230 1363 25 28
ENSDART00000129486 Essential Splice Site 113 246 8 11

The following transcripts of ENSDARG00000092126 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 22 (position 25224341)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24724247
GRCz11 22 24751871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACATGAAGATCTGTGCTGATGGTGCTCTGCTGAGCAAGCACAAAGTCACT[G/T]TAAGACTGGAACATTTGGTAACATGTATTTCTCTACTTCAGTACCATTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link