zgc:113443

Ensembl ID:
ENSDARG00000092093
ZFIN ID:
ZDB-GENE-050913-134
Description:
Zgc:113443 [Source:UniProtKB/TrEMBL;Acc:Q4V9E3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa10325 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10325
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000081389 Nonsense 360 436 3 3
ENSDART00000106504 Nonsense 360 436 3 3
ENSDART00000127877 Nonsense 284 360 3 3
Genomic Location (Zv9):
Chromosome 3 (position 8641563)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 7418141
GRCz11 3 7303981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ATGAGAGGACTCACACTGGAGAGAAACCTTACAMGTGTTCACACTGCGAC[A/T]AGAGATTTAGTGCATTAGAAAGCCTGAAAAAACATGWGAGGATTCACACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link