zgc:136861

Ensembl ID:
ENSDARG00000092052
ZFIN ID:
ZDB-GENE-060421-6530
Description:
hypothetical protein LOC678541 [Source:RefSeq peptide;Acc:NP_001035390]
Human Orthologue:
GSTK1
Human Description:
glutathione S-transferase kappa 1 [Source:HGNC Symbol;Acc:16906]
Mouse Orthologue:
Gstk1
Mouse Description:
glutathione S-transferase kappa 1 Gene [Source:MGI Symbol;Acc:MGI:1923513]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32099 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa32099
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102133 Essential Splice Site 139 216 5 7
ENSDART00000141512 Essential Splice Site 139 223 5 8

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 34320031)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 32051531
GRCz11 16 32005561
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAATGTGGAGCACTCATCAGGACATAGTCCAGCCTGCCTCACTCACAGAG[G/A]TATGCTATGCTCATGATGATTACAAATTTAATCAAGATTAGGCGTGTGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link