si:dkey-238o14.1

Ensembl ID:
ENSDARG00000092051
ZFIN ID:
ZDB-GENE-081103-10
Human Orthologue:
NLRX1
Human Description:
NLR family member X1 [Source:HGNC Symbol;Acc:29890]
Mouse Orthologue:
Nlrx1
Mouse Description:
NLR family member X1 Gene [Source:MGI Symbol;Acc:MGI:2429611]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20305 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20305
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000137800 Nonsense 597 773 6 6
Genomic Location (Zv9):
Chromosome 4 (position 37560054)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 67710759
GRCz11 4 69736981
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTACTGCTTTCTTCACTTGAGCATTCAGGAGTTTATTGCAGCCCTTTAT[C/T]AACATCTGATTCTAGACAAAAACAAGAAGTTTGGATGGTTTTTTATACAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link