si:dkey-4c23.3

Ensembl ID:
ENSDARG00000092028
ZFIN ID:
ZDB-GENE-050208-668
Description:
Novel protein similar to vitellogenin 1 (Vg1) [Source:UniProtKB/TrEMBL;Acc:Q1MTC3]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1573 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1573
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000147643 Essential Splice Site 684 1496 13 28
Genomic Location (Zv9):
Chromosome 22 (position 25367694)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 24867600
GRCz11 22 24895224
KASP Assay ID:
554-1516.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATTTCTGAATGAGGATGGACAGCCAACRATTAGACAACTGTTTCAAGCT[G/A]TAGGTGAAACATTTTATAAATGCACTGTCTGTTAACAGTTTCATGTWTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link