zgc:112427

Ensembl ID:
ENSDARG00000092003
ZFIN ID:
ZDB-GENE-050417-322
Description:
Zgc:112427 protein [Source:UniProtKB/TrEMBL;Acc:Q566W4]
Human Orthologue:
CCS
Human Description:
copper chaperone for superoxide dismutase [Source:HGNC Symbol;Acc:1613]
Mouse Orthologue:
Ccs
Mouse Description:
copper chaperone for superoxide dismutase Gene [Source:MGI Symbol;Acc:MGI:1333783]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa5396 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa5396
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000138948 Nonsense 68 268 3 8
Genomic Location (Zv9):
Chromosome 7 (position 7811716)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 6759825
GRCz11 7 6918276
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGGCTCTGACGTCTCTTCAGGTCCAGACTCTGATCGAGAGCACCGGCAGA[C/T]GAGCCGTGCTGAAGGGAATGGGAGGATCAGACTCAGGTCAGMCCGCACAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Bipolar disorder: Large-scale genome-wide association analysis of bipolar disorder identifies a new susceptibility locus near ODZ4. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link