A3KNR9_DANRE

Ensembl ID:
ENSDARG00000091931
Description:
LOC555692 protein [Source:UniProtKB/TrEMBL;Acc:A3KNR9]
Human Orthologue:
GPATCH4
Human Description:
G patch domain containing 4 [Source:HGNC Symbol;Acc:25982]
Mouse Orthologue:
Gpatch4
Mouse Description:
G patch domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1913864]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa32096 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32096
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000088083 Nonsense 32 442 2 8
Genomic Location (Zv9):
Chromosome 16 (position 31253906)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 29091095
GRCz11 16 29025718
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTTATGGTTGTGTGTGTGTGTGTGTGTGTTGTAGGTAAAGGTCTGGGC[A/T]GAGCAGAGAATGGCATTTCAGAGGCGATTAAAGTCAAAGTTAAATGTGAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link