si:dkeyp-122a11.1

Ensembl ID:
ENSDARG00000091927
ZFIN ID:
ZDB-GENE-081105-49
Description:
LOC553274 protein [Source:UniProtKB/TrEMBL;Acc:Q0VFW3]
Human Orthologue:
CCDC141
Human Description:
coiled-coil domain containing 141 [Source:HGNC Symbol;Acc:26821]
Mouse Orthologue:
Ccdc141
Mouse Description:
coiled-coil domain containing 141 Gene [Source:MGI Symbol;Acc:MGI:1919735]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa11814 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa11814
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000059451 Nonsense 359 469 7 9

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 44191292)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 43316462
GRCz11 9 43118249
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGCCTCATGATGAGTAGACAGGCTCATCTGCAAGAGAGCAATRCTTTTTA[C/A]AGCAGCGCTAATAAAGTACGTAATCAAGYAGCACTTCACATACTTTGACT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link