
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ugt5b2
- Ensembl ID:
- ENSDARG00000091916
- ZFIN IDs:
- ZDB-GENE-060421-3572, ZDB-GENE-100406-3, ZDB-GENE-100406-3, ZDB-GENE-100406-4
- Description:
- UDP glucuronosyltransferase 5 family, polypeptide B2 [Source:RefSeq peptide;Acc:NP_001170970]
- Human Orthologue:
- UGT8
- Human Description:
- UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
- Mouse Orthologue:
- Ugt8a
- Mouse Description:
- UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa32596 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa39552 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa32596
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016750 | None | 532 | None | 2 | |
ENSDART00000123773 | Essential Splice Site | None | 531 | None | 3 |
ENSDART00000126877 | Essential Splice Site | None | 531 | None | 2 |
ENSDART00000127735 | Essential Splice Site | None | 531 | None | 2 |
The following genes are also affected by this mutation:
- Genomic Location (Zv9):
- Chromosome 1 (position 8728583)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 8968388 GRCz11 1 9652499 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGTTGTTTGGACGTTGTCGAAGTTTTTATTGGGATATTTCCCATCTCTGG[T/G]GAGTTGTTGTATCGCATGTCGTATTTTTATGCCTATATAAGAGCAATGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39552
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000016750 | Nonsense | 491 | 532 | 2 | 2 |
ENSDART00000123773 | None | 531 | None | 3 | |
ENSDART00000126877 | None | 531 | None | 2 | |
ENSDART00000127735 | Nonsense | 490 | 531 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 1 (position 8719239)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 8959044 GRCz11 1 9643155 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGTGCCGCTCACTTGCGCACAGAGTCGTACAAAATGCCCTGGTACTCTTA[T/G]CACTCTGTTGATGTTATTCTGGTGCTGATTTCTGCTGTGTCACTCATAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: