ugt5b2

Ensembl ID:
ENSDARG00000091916
ZFIN IDs:
ZDB-GENE-060421-3572, ZDB-GENE-100406-3, ZDB-GENE-100406-3, ZDB-GENE-100406-4
Description:
UDP glucuronosyltransferase 5 family, polypeptide B2 [Source:RefSeq peptide;Acc:NP_001170970]
Human Orthologue:
UGT8
Human Description:
UDP glycosyltransferase 8 [Source:HGNC Symbol;Acc:12555]
Mouse Orthologue:
Ugt8a
Mouse Description:
UDP galactosyltransferase 8A Gene [Source:MGI Symbol;Acc:MGI:109522]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32596 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39552 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa32596
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016750   None 532 None 2
ENSDART00000123773 Essential Splice Site None 531 None 3
ENSDART00000126877 Essential Splice Site None 531 None 2
ENSDART00000127735 Essential Splice Site None 531 None 2

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 8728583)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8968388
GRCz11 1 9652499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGTTTGGACGTTGTCGAAGTTTTTATTGGGATATTTCCCATCTCTGG[T/G]GAGTTGTTGTATCGCATGTCGTATTTTTATGCCTATATAAGAGCAATGGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39552
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016750 Nonsense 491 532 2 2
ENSDART00000123773   None 531 None 3
ENSDART00000126877   None 531 None 2
ENSDART00000127735 Nonsense 490 531 2 2
Genomic Location (Zv9):
Chromosome 1 (position 8719239)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8959044
GRCz11 1 9643155
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGTGCCGCTCACTTGCGCACAGAGTCGTACAAAATGCCCTGGTACTCTTA[T/G]CACTCTGTTGATGTTATTCTGGTGCTGATTTCTGCTGTGTCACTCATAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link