si:dkey-29d8.3

Ensembl ID:
ENSDARG00000091879
ZFIN IDs:
ZDB-GENE-030131-4226, ZDB-GENE-070912-508
Description:
wu:fc83f10 [Source:RefSeq peptide;Acc:NP_001104304]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa2043 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2043
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000131369 Nonsense 111 294 3 7
ENSDART00000148045 Nonsense 75 232 2 7

The following transcripts of ENSDARG00000091879 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 2 (position 20982683)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 21528621
GRCz11 2 21186683
KASP Assay ID:
554-2803.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCTGTATTCTTTGTTTCATGGATCATCAACCTGATTTTAAACTGCTCCT[G/A]GCTGGTCTTGTGGGATAGAGAGTAAGTTGTGGCCAACTTTCCTTTCACTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link