zgc:194007

Ensembl ID:
ENSDARG00000091860
ZFIN ID:
ZDB-GENE-081022-49
Description:
hypothetical protein LOC565039 [Source:RefSeq peptide;Acc:NP_001129446]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa9292 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9292
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000145137 Nonsense 26 163 2 6

The following transcripts of ENSDARG00000091860 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 44757467)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 42710249
GRCz11 8 42717036
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TATTGTGGTATTTCCTTAGATGCATTTTGTTCTCAAAAGAAGAGGGATGT[C/T]AACTGTGCTATAAATGTACCAGGTAAGAGATTATTTATATTAYGTTTGCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link