zgc:154067

Ensembl ID:
ENSDARG00000091851
ZFIN ID:
ZDB-GENE-060929-918
Description:
tRNA-splicing endonuclease subunit Sen2 [Source:RefSeq peptide;Acc:NP_001070119]
Human Orthologue:
TSEN2
Human Description:
tRNA splicing endonuclease 2 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:28422]
Mouse Orthologue:
Tsen2
Mouse Description:
tRNA splicing endonuclease 2 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:2141599]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41748 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41748
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000104505 Nonsense 43 190 2 7
Genomic Location (Zv9):
Chromosome 11 (position 580918)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 567655
GRCz11 11 594153
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTCAGGCTTTTTTTCTGGTCTATGCTCTTGGATGCTTGTCCATTTATTA[T/G]AATGGGGTGAGTTTGAGCTCTCTTTTACTGGATGTCCACCAATTGTTGAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link