
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000091844
- Ensembl ID:
- ENSDARG00000091844
- Human Orthologue:
- ADAMTS13
- Human Description:
- ADAM metallopeptidase with thrombospondin type 1 motif, 13 [Source:HGNC Symbol;Acc:1366]
- Mouse Orthologue:
- Adamts13
- Mouse Description:
- a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 13 Gene
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38214 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32563 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38214
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126385 | Nonsense | 300 | 692 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA786 (position 21446)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150603.1 21446 GRCz11 KN150603.1 21446 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAACAACAACAAGCAAACCACCATCCAAATCCAAAACAACCACCAAAGTG[C/T]GAACCACAACCACAGCACAAACCACCTTGTCAACAAGCACACCTCAGTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32563
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126385 | Nonsense | 306 | 692 | 6 | 6 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA786 (position 21464)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN150603.1 21464 GRCz11 KN150603.1 21464 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACCATCCAAATCCAAAACAACCACCAAAGTGCGAACCACAACCACAGCA[C/T]AAACCACCTTGTCAACAAGCACACCTCAGTTACACACAACATCAGACGCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Coagulation factor levels: Linkage analysis identifies a locus for plasma von Willebrand factor undetected by genome-wide association. (View Study)
- Liver enzyme levels: Population-based genome-wide association studies reveal six loci influencing plasma levels of liver enzymes. (View Study)
- Prothrombin time: Genetic associations for activated partial thromboplastin time and prothrombin time, their gene expression profiles, and risk of coronary artery disease. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: