ZBTB40

Ensembl ID:
ENSDARG00000091762
Description:
zinc finger and BTB domain containing 40 [Source:HGNC Symbol;Acc:29045]
Human Orthologue:
ZBTB40
Human Description:
zinc finger and BTB domain containing 40 [Source:HGNC Symbol;Acc:29045]
Mouse Orthologue:
Zbtb40
Mouse Description:
zinc finger and BTB domain containing 40 Gene [Source:MGI Symbol;Acc:MGI:2682254]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa38857 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21957 Nonsense Available for shipment Available now
sa6217 Essential Splice Site Mutation detected in F1 DNA During 2018
sa35138 Nonsense Mutation detected in F1 DNA During 2018
sa38856 Nonsense Mutation detected in F1 DNA During 2018
sa14144 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa38857
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Essential Splice Site 186 1090 2 21
Genomic Location (Zv9):
Chromosome 11 (position 37286744)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36183972
GRCz11 11 36445955
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTCAGTTTCTTGAGGCCTGGGATGCAGTTTCCACAGAAGAGCGACAGG[T/A]ACAATTTTAGTAGGAGAGATGAATAATCAAGAATAATTAAGACTTCATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21957
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Nonsense 345 1090 9 21
Genomic Location (Zv9):
Chromosome 11 (position 37281218)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36178446
GRCz11 11 36440429
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCCTTTCTGTCAGGTGTAACGACAAAAGAGAGCAATGCAGTTGATTTGT[T/A]GGGAATGTATCAGAGCAGACTTGTTGAGCTGAATCTGGACCTCCAGCTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6217
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Essential Splice Site 378 1090 9 21
Genomic Location (Zv9):
Chromosome 11 (position 37281116)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36178344
GRCz11 11 36440327
KASP Assay ID:
554-4453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACAAAGCCTTCAAATGGGTCCAGAGATGCCTGAAAATGACAGACAGG[T/C]ACATGTGCTGCGTTGTTAGATACTTTTTTTTTANGCAAATCCCTAAGATAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35138
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Nonsense 482 1090 12 21
Genomic Location (Zv9):
Chromosome 11 (position 37278152)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36175380
GRCz11 11 36437363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCATCAGTGATTTTACAGTGCTTGAACAGGGTTTGAATGCAATGGATCAT[G/T]AGACAGAGAAAGTTACTGAGGTAAGAAATAAATATTGATTATTTTCTCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38856
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Nonsense 764 1090 16 21
Genomic Location (Zv9):
Chromosome 11 (position 37270887)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36168115
GRCz11 11 36430098
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTCGTTCGCACAGTCTATTGAACTGACACGTCACGTCCGCACACACACC[G/T]GAGACAAACCCTACGTCTGCAGAGAGTGTGGGAAAGGCTTCAAACAAGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14144
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128889 Nonsense 953 1090 20 21
Genomic Location (Zv9):
Chromosome 11 (position 37266053)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 36163281
GRCz11 11 36425264
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
ACYCTTTGTGTGTGTGTGTGTGTGTGTGTGKGTTCAGATGTGCAYGTGTG[G/A]AAGTGTGTGAGCTGTGACTGTTCTCTGTCCAGTGAGCAGGAGCTCCAGYA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link