zgc:112234

Ensembl ID:
ENSDARG00000091728
ZFIN IDs:
ZDB-GENE-050320-24, ZDB-GENE-050522-106, ZDB-GENE-071004-32, ZDB-GENE-071004-56
Description:
Histone H2B 1/2 [Source:UniProtKB/Swiss-Prot;Acc:Q5BJA5]
Human Orthologues:
HIST1H2BA, HIST2H2BE
Human Descriptions:
histone cluster 1, H2ba [Source:HGNC Symbol;Acc:18730]
histone cluster 2, H2be [Source:HGNC Symbol;Acc:4760]
Mouse Orthologue:
Hist1h2ba
Mouse Description:
histone cluster 1, H2ba Gene [Source:MGI Symbol;Acc:MGI:2448375]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32544 Nonsense Available for shipment Available now
sa14526 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32544
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126590 Nonsense 41 133 1 2
ENSDART00000130784 Nonsense 41 133 1 2
Genomic Location (Zv9):
Chromosome 25 (position 36105895)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34540163
GRCz11 25 35045121
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAAAGAAGCGTAAGAGGACCAGGAAGGAGAGCTACGCTATCTACGTGTA[C/A]AAGGTTTTGAAGCAAGTTCATCCCGACACCGGAATCTCTTCAAAGGCGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa14526
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126590 Nonsense 46 133 1 2
ENSDART00000130784 Nonsense 46 133 1 2
Genomic Location (Zv9):
Chromosome 25 (position 36105882)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 34540150
GRCz11 25 35045108
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAGRACCAGGAAGGAGAGCTAYGCTATCTACGTSTACAAGGTTTTGAAR[C/T]AAGTTCATCCCGACACCGGWATCTCTTCAAAGGCGATGGGCATCATGAAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link