si:dkey-24n17.4

Ensembl ID:
ENSDARG00000091726
ZFIN ID:
ZDB-GENE-030131-2390
Human Orthologue:
AEBP1
Human Description:
AE binding protein 1 [Source:HGNC Symbol;Acc:303]
Mouse Orthologue:
Aebp1
Mouse Description:
AE binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197012]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16060 Essential Splice Site Available for shipment Available now
sa6154 Nonsense Mutation detected in F1 DNA During 2018
sa38770 Essential Splice Site, Missense Mutation detected in F1 DNA During 2018
sa34810 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16060
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126440 Essential Splice Site 206 1022 4 20
ENSDART00000131435 Essential Splice Site 206 1020 4 20
Genomic Location (Zv9):
Chromosome 10 (position 2841159)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2786796
GRCz11 10 2813967
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACACCTCCATCAGTCAAAGAGCATRTGCCGGATAACTGGGACAGCCGAC[G/A]TATGTTTAAAGCAGCATCCATTACTCTSTYTTAAAGGAACACTTCACTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6154
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126440 Nonsense 230 1022 5 20
ENSDART00000131435 Nonsense 230 1020 5 20
Genomic Location (Zv9):
Chromosome 10 (position 2842076)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2787713
GRCz11 10 2814884
KASP Assay ID:
554-4769.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATTCCTAAAGTCAAGCAGCCGTCCTCCACCGATGACCCGAGTATATA[C/A]TTACCAATCCCAGGTAATCAAGTACATACGCTRACAYTTCTWACCAAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38770
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site, Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126440 Missense 384 1022 10 20
ENSDART00000131435 Essential Splice Site 383 1020 None 20
Genomic Location (Zv9):
Chromosome 10 (position 2849868)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2795505
GRCz11 10 2822676
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGAGAGGTGGAGTTTACCGGTGTAATCACACAGGGCAGAAACTCAGAG[T/C]CAAAGTAAGTCAACCATCAAAACACTCACGTCGTTTTATAACAACACACG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126440 Nonsense 659 1022 17 20
ENSDART00000131435 Nonsense 657 1020 17 20
Genomic Location (Zv9):
Chromosome 10 (position 2859256)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2804893
GRCz11 10 2832064
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCAGTGTTTAATTTCTGAAACATATCTGTCCTCAGGTGGCGACTGAAACT[A/T]AAGCCATCATCAGCTGGATGGAGAGGACGCCGTTTGTTTTAGGCGCGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link