
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-24n17.4
- Ensembl ID:
- ENSDARG00000091726
- ZFIN ID:
- ZDB-GENE-030131-2390
- Human Orthologue:
- AEBP1
- Human Description:
- AE binding protein 1 [Source:HGNC Symbol;Acc:303]
- Mouse Orthologue:
- Aebp1
- Mouse Description:
- AE binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1197012]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16060 | Essential Splice Site | Available for shipment | Available now |
sa6154 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa38770 | Essential Splice Site, Missense | Mutation detected in F1 DNA | During 2018 |
sa34810 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16060
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126440 | Essential Splice Site | 206 | 1022 | 4 | 20 |
ENSDART00000131435 | Essential Splice Site | 206 | 1020 | 4 | 20 |
- Genomic Location (Zv9):
- Chromosome 10 (position 2841159)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 2786796 GRCz11 10 2813967 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AACACCTCCATCAGTCAAAGAGCATRTGCCGGATAACTGGGACAGCCGAC[G/A]TATGTTTAAAGCAGCATCCATTACTCTSTYTTAAAGGAACACTTCACTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6154
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126440 | Nonsense | 230 | 1022 | 5 | 20 |
ENSDART00000131435 | Nonsense | 230 | 1020 | 5 | 20 |
- Genomic Location (Zv9):
- Chromosome 10 (position 2842076)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 2787713 GRCz11 10 2814884 - KASP Assay ID:
- 554-4769.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CTCATTCCTAAAGTCAAGCAGCCGTCCTCCACCGATGACCCGAGTATATA[C/A]TTACCAATCCCAGGTAATCAAGTACATACGCTRACAYTTCTWACCAAAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38770
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site, Missense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126440 | Missense | 384 | 1022 | 10 | 20 |
ENSDART00000131435 | Essential Splice Site | 383 | 1020 | None | 20 |
- Genomic Location (Zv9):
- Chromosome 10 (position 2849868)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 2795505 GRCz11 10 2822676 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACGAGAGGTGGAGTTTACCGGTGTAATCACACAGGGCAGAAACTCAGAG[T/C]CAAAGTAAGTCAACCATCAAAACACTCACGTCGTTTTATAACAACACACG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34810
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126440 | Nonsense | 659 | 1022 | 17 | 20 |
ENSDART00000131435 | Nonsense | 657 | 1020 | 17 | 20 |
- Genomic Location (Zv9):
- Chromosome 10 (position 2859256)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 2804893 GRCz11 10 2832064 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGTGTTTAATTTCTGAAACATATCTGTCCTCAGGTGGCGACTGAAACT[A/T]AAGCCATCATCAGCTGGATGGAGAGGACGCCGTTTGTTTTAGGCGCGAAT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: