GIMAP8 (40 of 111)

Ensembl ID:
ENSDARG00000091707
Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Human Orthologue:
GIMAP8
Human Description:
GTPase, IMAP family member 8 [Source:HGNC Symbol;Acc:21792]
Mouse Orthologue:
Gimap8
Mouse Description:
GTPase, IMAP family member 8 Gene [Source:MGI Symbol;Acc:MGI:2685303]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45087 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45087
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127947 Essential Splice Site 190 608 1 9
Genomic Location (Zv9):
Chromosome 1 (position 57289043)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150566.1 36889
GRCz11 1 56742688
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAAGATTGAGAAGATGGTGGAGGAGAATGGAGGAAAACACTACAGTATA[G/T]TGAAAATGAGCTATAAAAGCGAGAAAGTGAATCAAAACTCATTTAACTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link