
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:100994
- Ensembl ID:
- ENSDARG00000091683
- ZFIN ID:
- ZDB-GENE-040801-126
- Description:
- hypothetical protein LOC445213 [Source:RefSeq peptide;Acc:NP_001003607]
- Human Orthologue:
- CNRIP1
- Human Description:
- cannabinoid receptor interacting protein 1 [Source:HGNC Symbol;Acc:24546]
- Mouse Orthologue:
- Cnrip1
- Mouse Description:
- cannabinoid receptor interacting protein 1 Gene [Source:MGI Symbol;Acc:MGI:1917505]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa9516 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa9516
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000130828 | Nonsense | 120 | 162 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 1 (position 52103699)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 50951060 GRCz11 1 51594859 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTGTCGTTGRCTCGCAGTTCAAAGACGCCGGGATGTTCGAAACCGTCTGG[C/T]AAGTRAAATACTACAACTACTACAAGAGAGAGCACTGCAACTTCGGCAAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: