
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
NRCAM (2 of 2)
- Ensembl ID:
- ENSDARG00000091662
- Description:
- neuronal cell adhesion molecule [Source:HGNC Symbol;Acc:7994]
- Human Orthologue:
- NRCAM
- Human Description:
- neuronal cell adhesion molecule [Source:HGNC Symbol;Acc:7994]
- Mouse Orthologue:
- Nrcam
- Mouse Description:
- neuron-glia-CAM-related cell adhesion molecule Gene [Source:MGI Symbol;Acc:MGI:104750]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa16577 | Nonsense | Available for shipment | Available now |
sa45842 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa16577
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125270 | Nonsense | 221 | 445 | 5 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 47176)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- ATTACCGGCGCGAGYGCAGTCTGCACYGCCACAACTCTCACCACGCAGAG[C/T]AGCGCAGCAAGACCTTCAGCACCGGCAGCAGCAGCGGACGCCTGACAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45842
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000125270 | Nonsense | 320 | 445 | 7 | 13 |
- Genomic Location (Zv9):
- Chromosome 25 (position 51450)
- KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCTCGCTCCGCCCCGACCCCCCCAGTGAGCAGCAGCAGTGATGCGGGT[G/T]AGCTGCAGGAGCTGGAGCTGCCGGCCAATCACAGCAGTGTATTCCTGCAC
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Coffee consumption: Genome-wide association analysis of coffee drinking suggests association with CYP1A1/CYP1A2 and NRCAM. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: