Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000091661
- Ensembl ID:
- ENSDARG00000091661
- Mouse Orthologue:
- Gm1123
- Mouse Description:
- predicted gene 1123 Gene [Source:MGI Symbol;Acc:MGI:2685969]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa24792 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24792
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- G > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000127229 | Nonsense | 221 | 320 | 3 | 5 |
- Genomic Location (Zv9):
- Chromosome Zv9_NA303 (position 4967)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 KN149998.1 4967 GRCz11 KN149998.1 4967 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATGAGCGATACAGAGAGCGTGTGGAGTTTTTCTCCTCTGAAATCTCCAAA[G/T]GAAACTTCTCTGTCCGACTGAGGAGCATCAGAACTGAAGATGCAGGAGTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
