Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
wu:fc20g06
- Ensembl ID:
- ENSDARG00000091660
- ZFIN ID:
- ZDB-GENE-030131-2883
- Human Orthologue:
- FGFBP1
- Human Description:
- fibroblast growth factor binding protein 1 [Source:HGNC Symbol;Acc:19695]
- Mouse Orthologue:
- Fgfbp1
- Mouse Description:
- fibroblast growth factor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1096350]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa19491 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19491
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000128918 | Nonsense | 98 | 206 | 1 | 1 |
- Genomic Location (Zv9):
- Chromosome 1 (position 21452033)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 21987200 GRCz11 1 22677939 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GACGGATTCACCTGTAAATACACTGCCAAGCCGGCAACGTGCGCCGAATA[T/A]TCGTCTAATCCCAAGGGCTACTGGAAACAGATAGCCAGATCTCTGCAAAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
