wu:fc20g06

Ensembl ID:
ENSDARG00000091660
ZFIN ID:
ZDB-GENE-030131-2883
Human Orthologue:
FGFBP1
Human Description:
fibroblast growth factor binding protein 1 [Source:HGNC Symbol;Acc:19695]
Mouse Orthologue:
Fgfbp1
Mouse Description:
fibroblast growth factor binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1096350]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa19491 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19491
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128918 Nonsense 98 206 1 1
Genomic Location (Zv9):
Chromosome 1 (position 21452033)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 21987200
GRCz11 1 22677939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GACGGATTCACCTGTAAATACACTGCCAAGCCGGCAACGTGCGCCGAATA[T/A]TCGTCTAATCCCAAGGGCTACTGGAAACAGATAGCCAGATCTCTGCAAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link