zgc:136867

Ensembl ID:
ENSDARG00000091658
ZFIN ID:
ZDB-GENE-060421-6887
Description:
Small subunit of serine palmitoyltransferase B [Source:UniProtKB/Swiss-Prot;Acc:Q1RLT2]
Human Orthologue:
C3orf57
Human Description:
chromosome 3 open reading frame 57 [Source:HGNC Symbol;Acc:24045]
Mouse Orthologue:
1110032A04Rik
Mouse Description:
RIKEN cDNA 1110032A04 gene Gene [Source:MGI Symbol;Acc:MGI:1913433]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42467 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42467
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126456 Nonsense 16 78 1 1
Genomic Location (Zv9):
Chromosome 15 (position 1677942)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 1717827
GRCz11 15 1682736
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCGCATGGACATGAAGAACATGAGAGAGTACATGAGCTGGCTCTACTAC[C/T]AGTATCTGCTCATCACTGGGATCTATGTGCTGGAGCCGTGGGAGCAGTCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link