xrn1
- Ensembl ID:
- ENSDARG00000091652
- ZFIN IDs:
- ZDB-GENE-040426-1203, ZDB-GENE-040426-1203
- Description:
- 5'-3' exoribonuclease 1 [Source:RefSeq peptide;Acc:NP_957327]
- Human Orthologue:
- XRN1
- Human Description:
- 5'-3' exoribonuclease 1 [Source:HGNC Symbol;Acc:30654]
- Mouse Orthologue:
- Xrn1
- Mouse Description:
- 5'-3' exoribonuclease 1 Gene [Source:MGI Symbol;Acc:MGI:891964]
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa31269 |
Nonsense |
Available for shipment |
Available now |
sa19713 |
Nonsense |
Available for shipment |
Available now |
sa19714 |
Nonsense |
Available for shipment |
Available now |
sa32872 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa32873 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa6008 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa32874 |
Essential Splice Site |
Available for shipment |
Available now |
sa45094 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa39802 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa19715 |
Nonsense |
Available for shipment |
Available now |
sa19716 |
Essential Splice Site |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa31269
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16417717)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16928544 |
GRCz11 |
2 |
16597134 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTATTTTTATTTGAAGACTTACACGAGACGATGGGAGTGCCTAAGTTTTA[T/A]CGATGGATATCAGAGCGGTATCCGTGTCTGAGTGAAGTTGTCAAAGAGCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19713
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16420327)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16931154 |
GRCz11 |
2 |
16599744 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGCACTTCCGTATTTCTGAAGAGAAGATATTCGCTGACATTTTTCACTA[T/A]CTGGAAGTGCTCTTTCGCATCATTAAGCCAAGGAAAGTGTTCTTCATGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19714
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16421250)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16932077 |
GRCz11 |
2 |
16600667 |
- KASP Assay ID:
- 2259-1799.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAAAATCAAGAAGGCCTTGGAGAAGGGAGAAGTTTTGCCCACAGAGGCC[C/T]GATTTGACTCTAACTGCATCACTCCGGGTTTGTGTTCATTTATCGCTTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32872
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 16444259)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16955086 |
GRCz11 |
2 |
16623676 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAAAGAGCAGAAGGACTGGGTCAAAGAAGTGCAAGGCCTCACAGAGCAG[T/A]AAGCTGAAACCTTTATTAACTTTATTTATTCACGTAATTTATTAACAAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32873
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
- Genomic Location (Zv9):
- Chromosome 2 (position 16446454)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16957281 |
GRCz11 |
2 |
16625871 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GCAGTTTGCCAAGCAGGTCCTGCCCTTTCCATATCAGACCATTGTGAAGG[T/G]AAATATTCGCACCAAAACAAAATATTCATGAATAAACGTCAGCATTAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa6008
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16451964)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16962791 |
GRCz11 |
2 |
16631381 |
- KASP Assay ID:
- 554-3881.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCCAAGAGATCCAGGGCTGGWTGAAAACGCATCCAGTGAGCTCCATCTCC[A/T]GAGCATCATGTGATCTGCAGATCCTGGATGCTGGTATTGTGGAGAAGATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32874
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000121772 |
|
None |
504 |
None |
18 |
ENSDART00000125413 |
Essential Splice Site |
1067 |
1697 |
27 |
42 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16452040)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16962867 |
GRCz11 |
2 |
16631457 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGATGCTGGTATTGTGGAGAAGATTGAGGAGGAGCTGGAGAAAACGAAGG[T/G]GAGGATCACATACAAAAATTGACAATCACAGTTACTGTTGCTGGCATTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45094
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16453157)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16963984 |
GRCz11 |
2 |
16632574 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGCTTCCACTTTTATTGTTCAACAGCTGACCGTGAGGCTGAAATTCTATA[T/A]GAGGTGATATTTGATGAGGAGTTTGCTGGAGGACTCACTATCAGGTACAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39802
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16456205)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16967032 |
GRCz11 |
2 |
16635622 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACTCAGGGCAACAGGAACTCGCCACATAAAGCCCTCAACCAGAGAAAC[C/T]AACAAAAGGTATGAAGTGTGAGGTTAATAGGCCTTTTCTGCTGTGGGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19715
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 2 (position 16463553)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16974380 |
GRCz11 |
2 |
16642970 |
- KASP Assay ID:
- 2259-1800.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTTCATATCATTTGCTCTTTTCTCTATGTTCTGCAGAGTCTGATCTTGTG[T/A]CAGGTGAAGTTGTCGAATGGTCTGATGGTTCACGGCCCTCAGTGTCAGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19716
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000121772 |
|
None |
504 |
None |
18 |
ENSDART00000125413 |
Essential Splice Site |
1607 |
1697 |
41 |
42 |
- Genomic Location (Zv9):
- Chromosome 2 (position 16464644)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
2 |
16975471 |
GRCz11 |
2 |
16644061 |
- KASP Assay ID:
- 2259-1801.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTGCCATCAGCAGCCGGCGGATCCCATAACCAGTTTGTTCCCCTTCAG[G/A]TAATGATTTGCGTCTAGACATGCACACGGAAATCAGTGGCTGTGTTTACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: