UNC13A (5 of 5)

Ensembl ID:
ENSDARG00000091647
Description:
unc-13 homolog A (C. elegans) [Source:HGNC Symbol;Acc:23150]
Human Orthologue:
UNC13A
Human Description:
unc-13 homolog A (C. elegans) [Source:HGNC Symbol;Acc:23150]
Mouse Orthologue:
Unc13a
Mouse Description:
unc-13 homolog A (C. elegans) Gene [Source:MGI Symbol;Acc:MGI:3051532]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa30475 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30475
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000126567 Essential Splice Site 189 604 6 16
Genomic Location (Zv9):
Chromosome Zv9_NA337 (position 17887)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN150038.1 17887
GRCz11 KN150038.1 17887
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTGCGCGTTCAGCTGGAGAAGATGTTTGAGGCCATGGGAGGGAAAGACG[T/A]GAGTTCATCAATGCATTTACTCATTAACTGATTACAGTAACACTGCATGT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link