si:dkey-97a13.9

Ensembl ID:
ENSDARG00000091628
ZFIN ID:
ZDB-GENE-070912-619
Human Orthologue:
CSPP1
Human Description:
centrosome and spindle pole associated protein 1 [Source:HGNC Symbol;Acc:26193]
Mouse Orthologue:
Cspp1
Mouse Description:
centrosome and spindle pole associated protein 1 Gene [Source:MGI Symbol;Acc:MGI:2681832]

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39903 Nonsense Mutation detected in F1 DNA During 2018
sa15893 Nonsense Available for shipment Available now
sa17629 Essential Splice Site Available for shipment Available now
sa19834 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa39903
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129539 Nonsense 3 877 1 27
ENSDART00000140188   None 704 None 21
ENSDART00000142792 Nonsense 3 84 2 4
Genomic Location (Zv9):
Chromosome 2 (position 42169962)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42219426
GRCz11 2 42068844
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTAGTTCTATGTATTTCCAGGTATATATGTGTATTTTTTTCCAGATGGAT[G/T]AAGTGCTGGAGAAGTTTCTGGAAGAGCAGAAGACAAAGATAGCAGAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129539 Nonsense 139 877 5 27
ENSDART00000140188   None 704 None 21
ENSDART00000142792   None 84 None 4
Genomic Location (Zv9):
Chromosome 2 (position 42167805)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42217269
GRCz11 2 42066687
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGTGTGTGTAGCTCTGAGGAAGATGTCAGTGATGAAGAACTCATGCTTT[T/A]ACAAGGGAGGYGGCATCAGAGAGAGAGAGACACCAGGGCAAGGAACAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129539 Essential Splice Site 357 877 13 27
ENSDART00000140188 Essential Splice Site 184 704 7 21
ENSDART00000142792   None 84 None 4
Genomic Location (Zv9):
Chromosome 2 (position 42154544)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42204008
GRCz11 2 42053426
KASP Assay ID:
2259-2467.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGCAGTAACWCCCGAAAAGATSTGATTYAGCAATGCATGTTGGTGTTTCA[G/A]GAGGTTTCTAGGTGAGAATGAAGGTGTGGGTTCAGGTCATCCAGCGTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19834
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129539 Essential Splice Site 822 877 None 27
ENSDART00000140188 Essential Splice Site 649 704 None 21
ENSDART00000142792   None 84 None 4
Genomic Location (Zv9):
Chromosome 2 (position 42140481)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 42189945
GRCz11 2 42039363
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTGTATTTAGTGATTGTGGTGATGCAGAACTCATTTGTGTGTTTGTGTTC[A/T]GGAGGCTGCTCTGATGAAGACGACGAGGCTGAAGTTGTTGGTCGCGGTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link