zgc:171947

Ensembl ID:
ENSDARG00000091601
ZFIN ID:
ZDB-GENE-071004-48
Description:
hypothetical protein LOC792207 [Source:RefSeq peptide;Acc:NP_001103192]
Human Orthologues:
AC008537.2, CYP2A7P1
Human Description:
cytochrome P450, family 2, subfamily A, polypeptide 7 pseudogene 1 [Source:HGNC Symbol;Acc:2612]
Mouse Orthologues:
Cyp2ab1, Cyp2j13
Mouse Descriptions:
cytochrome P450, family 2, subfamily ab, polypeptide 1 Gene [Source:MGI Symbol;Acc:MGI:3644957]
cytochrome P450, family 2, subfamily j, polypeptide 13 Gene [Source:MGI Symbol;Acc:MGI:2385197]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa18503 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa18503
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007810 Nonsense 486 499 9 9
Genomic Location (Zv9):
Chromosome 23 (position 42958224)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42392735
GRCz11 23 42358231
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAGAGAAGTGGCCAGATATGAATAGGATTCTCAGTGTGATTCGCTCTCCT[G/T]AACCATTYAACATCATCTGCWATAGCAGAGATTCARAACACTGACCAYCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link