Alleles
There are 16 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa32167 |
Essential Splice Site |
Available for shipment |
Available now |
sa11459 |
Essential Splice Site |
Available for shipment |
Available now |
sa16123 |
Nonsense |
Available for shipment |
Available now |
sa16149 |
Nonsense |
Available for shipment |
Available now |
sa14840 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa42980 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa5903 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15359 |
Nonsense |
Available for shipment |
Available now |
sa36482 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa23141 |
Nonsense |
Available for shipment |
Available now |
sa16538 |
Nonsense |
Available for shipment |
Available now |
sa36483 |
Nonsense |
Available for shipment |
Available now |
sa12181 |
Nonsense |
Available for shipment |
Available now |
sa28904 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa23142 |
Nonsense |
Available for shipment |
Available now |
sa36484 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa32167
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Essential Splice Site |
16 |
3594 |
1 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38644082)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38528979 |
GRCz11 |
17 |
38476564 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAATGGCCAACGTGAAAGTCGCGATTCGAGTCCGTCCACTGAACACCAGG[T/C]ACAGCAATCTGTTTTAAATAGCATGAATTAACTGTAAAGATGCATGAGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11459
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Essential Splice Site |
132 |
3594 |
5 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38678436)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38563333 |
GRCz11 |
17 |
38510918 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CCTCTTTGSCTTCTCAGGACTCCATTGGCCTGACACCAAGGATCTGTCAA[G/A]TAAGTCAAAACTGAAAATGGAATCARCATGTTCGCTCCTTCAYGTCATTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16123
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
201 |
3594 |
8 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38682802)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38567699 |
GRCz11 |
17 |
38515284 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATTGTGTGTTTATGTTAGGTCTTTCTCAGCATGTCGTGACTGACTACAAA[C/T]AAGCAGTGGATCTGTTGGAGGAGGGTATYGCTAACCGCATCACAGCCGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16149
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
760 |
3594 |
21 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38703507)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38588404 |
GRCz11 |
17 |
38535989 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGAATCGTGTGCGCCGCAAAAGGTTACATTACCAGCTGGAGAAGATTGCA[C/T]GAAAGCGCCATCTGTTGGAGGCAAAGCGTGAACTGCAGAGGCTGGAAAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14840
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
796 |
3594 |
21 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38703616)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38588513 |
GRCz11 |
17 |
38536098 |
- KASP Assay ID:
- 1641-0504.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGAAGGKTGCAATGAAACCTCATCTCTAGAATTGGCATACTCTTYAAAGT[T/A]AAGGGGACRTCCGATGACTTTAAGAAGGCATTCCTTTTCTGCTGATCTAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42980
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1171 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38704877)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38589774 |
GRCz11 |
17 |
38537359 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATAAATTGGAGACAAAAATATCCAAAGATGTGCCTGCAGAGGTTTACTG[G/A]AGCTTAAATGGTAGTCAGAAGCTAAAAACTGAGAATGGCCAAGGCATGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5903
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1269 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38705171)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38590068 |
GRCz11 |
17 |
38537653 |
- KASP Assay ID:
- 554-3929.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTGGATCTGATCGGCAACAAAAATGACTTAGAAAGCCAGAGCTCACCTYG[C/A]TCTGACACCACTCAGGGTGAAAATGCAACACTTGAATCAAAYGACACGTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15359
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1685 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38706417)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38591314 |
GRCz11 |
17 |
38538899 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTAAACTGGATGAATTCAAGTATGAGACGAAYCMCCATGAATATGATTAC[A/T]AAAGTATGCAGGATRGACAWTGTGAAAGTAGCTGTTCCCAGTTGTTCCCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36482
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1887 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38707024)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38591921 |
GRCz11 |
17 |
38539506 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGACTTGGCCAACTTCAAAAGAAATGCACAAATTTTATGAGCAACCAT[C/A]AATACATAAAACTTCAGGACTGTTAAATGAACTCAGATGTTCAGCAAGTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23141
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1900 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38707064)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38591961 |
GRCz11 |
17 |
38539546 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GAGCAACCATCAATACATAAAACTTCAGGACTGTTAAATGAACTCAGATG[T/A]TCAGCAAGTGAAAAATTTCTTATGGAGATGTCAACTCCAGTAGAGTCCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa16538
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
1911 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38707096)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38591993 |
GRCz11 |
17 |
38539578 |
- KASP Assay ID:
- 2261-1396.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTTAAATGAACTCAGATGTTCAGCAAGTGAAAMATTTCTTATGGAGATST[C/A]AACTCCAGTAGAGTCCAGTRAAYRTGACAATCTTCAAGCATCGCTACCCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36483
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
2457 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38708733)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38593630 |
GRCz11 |
17 |
38541215 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATAATAAAGGGCTCTCCAGCACACTGAGTAGTAATGGATATTCTAGAGAT[C/T]AAATTTCTTCTGAACCTTTGCTGAAGGCCACTTCTTTGTCCTCAAGTGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12181
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
2675 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38709387)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38594284 |
GRCz11 |
17 |
38541869 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GTAGTGTATCCCAGCTAGATGGTGAGGCCAAGATCTTGAAGAACAATTAT[G/T]AAAGTGAACAGGCCTAYGAMAGGATAAAAAGCATGCCTGATTTACGTCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28904
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
2772 |
3594 |
22 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38709678)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38594575 |
GRCz11 |
17 |
38542160 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAATCAGACTTGTACCAGAAATGTAGACCTAAAGAATGGCTTTAGTAAA[C/T]AAGTTATGCTTATGGATCGCGCATGCTCCCCTATCCTAACTCTGAAGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa23142
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
3395 |
3594 |
28 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38716103)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38601000 |
GRCz11 |
17 |
38548585 |
- KASP Assay ID:
- 2261-1399.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACATGAATGTGAAATACTTCATTGGTATGCTTGTCTGTTTTAGGTATATT[T/A]GGCCTCTGGAGGTGATGTGAGGAATCTGCTGGCTGGGAAGGCAGCAGCTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa36484
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000123298 |
Nonsense |
3480 |
3594 |
29 |
32 |
- Genomic Location (Zv9):
- Chromosome 17 (position 38716429)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
17 |
38601326 |
GRCz11 |
17 |
38548911 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACAACGAGTCTGTTAAATCTGCCTGGACACGACCACTGGATGAAAGCACA[C/T]AACTTGGTAAAACCCAAGATTTTTGATATCATAAAGGGTTTCTGTTGTCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: