si:dkey-22o12.2

Ensembl ID:
ENSDARG00000091513
ZFIN ID:
ZDB-GENE-060503-443
Description:
UPF0524 protein C3orf70 homolog A [Source:UniProtKB/Swiss-Prot;Acc:Q1LY84]
Human Orthologue:
C3orf70
Human Description:
chromosome 3 open reading frame 70 [Source:HGNC Symbol;Acc:33731]
Mouse Orthologue:
2510009E07Rik
Mouse Description:
RIKEN cDNA 2510009E07 gene Gene [Source:MGI Symbol;Acc:MGI:1919440]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19516 Nonsense Available for shipment Available now
sa19515 Nonsense Available for shipment Available now
sa31209 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19516
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 64 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29335468)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29544083
GRCz11 1 30348014
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAATGTTTCTTCTTTTATTTTCCCCATCTTTGCAGGTAAATACGTCTAC[C/T]AACCTATGACCAGCGTATGCCAACTTCCCAGCACAGCGGTTCCAGTCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19515
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 198 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29335065)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29543680
GRCz11 1 30347611
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAGATCTCAGCCCCTAAAATGGACCACTGCTCCTCTCCCTCCAGCT[C/A]AGAGGACTCTGGAATCAATGCATTGGGTTTGCACTACATGGAATCATGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31209
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125759 Nonsense 246 269 2 2
Genomic Location (Zv9):
Chromosome 1 (position 29334922)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 29543537
GRCz11 1 30347468
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGATGAGCTGAGTACTGATGGAAACTCCAGCCCAGGTAGCTTCTGGGAC[C/T]AGGACGAGTGCACTTTACTATCACCATCTAAATCAATCGTTGAGATCATT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link