zgc:112293

Ensembl ID:
ENSDARG00000091511
ZFIN ID:
ZDB-GENE-050522-419
Description:
glutathione peroxidase 7 [Source:RefSeq peptide;Acc:NP_001018337]
Human Orthologue:
GPX7
Human Description:
glutathione peroxidase 7 [Source:HGNC Symbol;Acc:4559]
Mouse Orthologue:
Gpx7
Mouse Description:
glutathione peroxidase 7 Gene [Source:MGI Symbol;Acc:MGI:1914555]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44055 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44055
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000125273 Nonsense 21 186 1 3
Genomic Location (Zv9):
Chromosome 23 (position 43050193)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 42775767
GRCz11 23 42231656
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTGAGGGCGTTTACTTTAATCACTTTAGTATGTCTGCTAGAGGCCAAA[C/T]AGAAAGACTTTTACACGTTTAAAGTGGTAAACAGCAGAGGCCGGTTAGTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link