zgc:174907

Ensembl ID:
ENSDARG00000091458
ZFIN ID:
ZDB-GENE-080204-89
Description:
potassium voltage-gated channel subfamily A member 2 [Source:RefSeq peptide;Acc:NP_001104640]
Human Orthologue:
KCNA2
Human Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 [Source:HGNC Symbol;Acc:6220]
Mouse Orthologue:
Kcna2
Mouse Description:
potassium voltage-gated channel, shaker-related subfamily, member 2 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39393 Essential Splice Site Mutation detected in F1 DNA During 2018
sa7308 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39393
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121427 Essential Splice Site None 495 1 3
Genomic Location (Zv9):
Chromosome 23 (position 5105073)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5096569
GRCz11 23 5032465
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTAATTTGTGTGCAGTTTGCTCCCACCATACATCTCCACCTAACTCAG[G/A]TTAGTCACTCATGTTCTTGGCTGTAGTGAGTCTCCTTACGTGGCTATTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7308
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121427 Nonsense 154 495 2 3
Genomic Location (Zv9):
Chromosome 23 (position 5127623)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 5076380
GRCz11 23 5012276
KASP Assay ID:
554-4759.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGAAACTACTGCCAGAGAATGAGTTTCAGAGGCAGGTATGGCTGCTTTTT[G/T]AGTACCCTGAAAGTTCAGGGCCTGCCCGGATTATTGCTATAATTTCAGTC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link