
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000091455
- Ensembl ID:
- ENSDARG00000091455
- Human Orthologues:
- CD207, CD209, CLEC4F, CLEC4M, FCER2
- Human Descriptions:
- C-type lectin domain family 4, member F [Source:HGNC Symbol;Acc:25357]
- C-type lectin domain family 4, member M [Source:HGNC Symbol;Acc:13523]
- CD207 molecule, langerin [Source:HGNC Symbol;Acc:17935]
- CD209 molecule [Source:HGNC Symbol;Acc:1641]
- Fc fragment of IgE, low affinity II, receptor for (CD23) [Source:HGNC Symbol;Acc:3612]
- Mouse Orthologues:
- Cd207, Cd209a, Cd209b, Cd209c, Cd209d, Cd209e, Cd209f, Cd209g, Clec4f, Fcer2a
- Mouse Descriptions:
- C-type lectin domain family 4, member f Gene [Source:MGI Symbol;Acc:MGI:1859834]
- CD207 antigen Gene [Source:MGI Symbol;Acc:MGI:2180021]
- CD209a antigen Gene [Source:MGI Symbol;Acc:MGI:2157942]
- CD209b antigen Gene [Source:MGI Symbol;Acc:MGI:1916415]
- CD209c antigen Gene [Source:MGI Symbol;Acc:MGI:2157945]
- CD209d antigen Gene [Source:MGI Symbol;Acc:MGI:2157947]
- CD209e antigen Gene [Source:MGI Symbol;Acc:MGI:2157948]
- CD209f antigen Gene [Source:MGI Symbol;Acc:MGI:1916392]
- CD209g antigen Gene [Source:MGI Symbol;Acc:MGI:1917442]
- Fc receptor, IgE, low affinity II, alpha polypeptide Gene [Source:MGI Symbol;Acc:MGI:95497]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa738 | Essential Splice Site | Available for shipment | Available now |
sa27559 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa8841 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa738
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122010 | Essential Splice Site | 110 | 374 | 1 | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 7530355)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 8551630 GRCz11 10 8510330 - KASP Assay ID:
- 554-0645.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- CCTTAATCGCAACAATGACCTGACGAAAGAAAGAGAGCAGATAYTGAAAA[G/A]CAAGAATGACCTTACGAAAGAAAGRGAGCAGATACTAAAAAACAACAATG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa27559
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122010 | Nonsense | 183 | 374 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 7531221)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 8552496 GRCz11 10 8511196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGAAAAAGAGCAGATACTGACACGCAACAATGAGCTGACTAAAGAAAAA[G/T]AGCAGATACTGAAACGTAACAATGACCTGACTAAAGAAAAAGAGCAGATA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8841
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000122010 | Nonsense | 370 | 374 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 10 (position 7534748)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 8556023 GRCz11 10 8514723 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TCAGAATAACAATTTATGGGTTGGCTGGAGACAGACAAATGGAGAMAATT[G/A]GATATGGATTGATGACCCTTYWGTGGCAAATGGGTGAGTGATCACCAATT
- Associated Phenotype:
- Not determined
OMIM
- Dengue fever, protection against
- HIV type 1, susceptibility to
- Mycobacterium tuberculosis, susceptibility to
More OMIM information for CD209
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: