ST18

Ensembl ID:
ENSDARG00000091410
Description:
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) [Source:HGNC Symbol;Acc:18
Human Orthologue:
ST18
Human Description:
suppression of tumorigenicity 18 (breast carcinoma) (zinc finger protein) [Source:HGNC Symbol;Acc:18
Mouse Orthologue:
St18
Mouse Description:
suppression of tumorigenicity 18 Gene [Source:MGI Symbol;Acc:MGI:2446700]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa14218 Nonsense Available for shipment Available now
sa37935 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa14218
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127491 Nonsense 10 766 1 23
Genomic Location (Zv9):
Chromosome 24 (position 36615729)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35234644
GRCz11 24 35120909
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGAGGCGTTTGGGGTCCYGGGCTGGTGGCCAGGCGTCTGGAGCTGGAC[C/T]GAGCTCGGCTGAACCTCAGTCTTCTAGAGCAGGCCATGGTGCTGCAGTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37935
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000127491 Nonsense 44 766 1 23
Genomic Location (Zv9):
Chromosome 24 (position 36615832)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 35234747
GRCz11 24 35121012
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCACAGACAGGTTCTCCACAGTGCCTATAAAGATATGGACCGCTTCTTCT[T/A]GGAGCAGATGAATCACGAACGAAGGCAGCAGAGGATGATGGAGATGGATG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link