VGF

Ensembl ID:
ENSDARG00000091371
Description:
VGF nerve growth factor inducible [Source:HGNC Symbol;Acc:12684]
Human Orthologue:
VGF
Human Description:
VGF nerve growth factor inducible [Source:HGNC Symbol;Acc:12684]
Mouse Orthologue:
Vgf
Mouse Description:
VGF nerve growth factor inducible Gene [Source:MGI Symbol;Acc:MGI:1343180]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16922 Nonsense Available for shipment Available now
sa34068 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa16922
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130710 Nonsense 106 642 1 1
Genomic Location (Zv9):
Chromosome 7 (position 27352634)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25955573
GRCz11 7 26226766
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCACTAAACCAGAAAGAAAAGATGAGTGAACGAGAAGATGAGGGAACT[G/T]AAGGGSAAAAGGAGAGGGATCTTCAGGGCGCAGACAGAGACAGAGATGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34068
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000130710 Nonsense 427 642 1 1
Genomic Location (Zv9):
Chromosome 7 (position 27353597)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 25956536
GRCz11 7 26227729
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCAGCAGACGATGTGGTGGACATCATTAATGATGTGGAGAAGAAGAAG[A/T]AAAAAGATGCTCCTGAAAATCTGCCATGGCAACATCCTCTTGTGCCGCCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link