ADAMTS2 (2 of 2)

Ensembl ID:
ENSDARG00000091328
Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 2 [Source:HGNC Symbol;Acc:218]
Human Orthologue:
ADAMTS2
Human Description:
ADAM metallopeptidase with thrombospondin type 1 motif, 2 [Source:HGNC Symbol;Acc:218]
Mouse Orthologue:
Adamts2
Mouse Description:
a disintegrin-like and metallopeptidase (reprolysin type) with thrombospondin type 1 motif, 2 Gene [

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa44405 Nonsense Mutation detected in F1 DNA During 2018
sa38188 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30476 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44405
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108490 Nonsense 48 537 2 12
Genomic Location (Zv9):
Chromosome Zv9_NA41 (position 39060)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49442896
GRCz11 14 48327273
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTAACGTAACATCCGTCTCATGTGTGTGTTTCAGTCCACGAGCCTCATT[G/T]AGCTGGGCAATCCTTCTCAGAGTCTGGAGAATGTGTGTCGCTGGGCTTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38188
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108490 Essential Splice Site 95 537 2 12
Genomic Location (Zv9):
Chromosome Zv9_NA41 (position 38917)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49442753
GRCz11 14 48327130
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGCCATCTTTCTCACGCGCCAAGAGTTCGGGCCCACAGGAATGCAAGG[T/G]AAAATACACACCGAGGCTTTAAAAAGCACACCATCTTGCTGTAGCCTTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30476
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108490 Essential Splice Site 453 537 10 12
Genomic Location (Zv9):
Chromosome Zv9_NA41 (position 4740)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 49408576
GRCz11 14 48292953
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAAGTGCAAAACTCACAAATTCGACTTCACCTATGAAAAAAAAAGAGG[T/C]ACGTCTCTCAAGTCCAGACACAATAGTGCAATGCAAGCGTATTATACACT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link