si:rp71-39b20.3

Ensembl ID:
ENSDARG00000091306
ZFIN ID:
ZDB-GENE-070912-703
Description:
small conductance calcium-activated potassium channel protein 1 [Source:RefSeq peptide;Acc:NP_00112
Human Orthologue:
KCNN1
Human Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 [Source:HG
Mouse Orthologue:
Kcnn1
Mouse Description:
potassium intermediate/small conductance calcium-activated channel, subfamily N, member 1 Gene [Sour

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19745 Nonsense Available for shipment Available now
sa6838 Nonsense Mutation detected in F1 DNA During 2018
sa12321 Nonsense Available for shipment Available now
sa11915 Nonsense Available for shipment Available now
sa13213 Nonsense Available for shipment Available now
sa32910 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19745
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 12 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23401978)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806517
GRCz11 2 24462168
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACGCGGATATTGAGGGGATGCGGCATCGGCACGCGGGAGCTGTCCACCAG[C/T]AGCACAGCAACGACGCGGACGCTCGTGACAGTCCAAAAGAAGCATCTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6838
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 76 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402172)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806323
GRCz11 2 24461974
KASP Assay ID:
554-4665.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCGGACCGCGGCACCAGGAACGACGAGTGCCTGCCTTTGACCGGCCACTG[C/A]AGCCTCGCGCAGGGAGCGCGCACCGACCGTCAGCCTTACGACAACCTGCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402449)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806046
GRCz11 2 24461697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAAYAAAGGGACCCCTCCTTTRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11915
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
ENSDART00000033922 Nonsense 169 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402449)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806046
GRCz11 2 24461697
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGACATCGTACAGCGTCGCGTCGGGGAGGGGGGGCGTCGAGACCAATAC[C/T]AGTTGCTGCAGCAACCTTGTTATAATCAAYAAAGGGACCCCTCCTTTRAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13213
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 179 890 1 9
ENSDART00000135104   None 538 None 8
ENSDART00000147885   None 261 None 4
Genomic Location (Zv9):
Chromosome 2 (position 23402479)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24806016
GRCz11 2 24461667
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGGGCGTCGAGACCAATACYAGTTGCTGCAGCAACCTTGTTATAATCAA[C/T]AAAGGGACCCCTCCTTTRAGCCACTCTTGCCAAACTCTAGTCAAGGACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32910
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000033922 Nonsense 523 890 4 9
ENSDART00000135104 Nonsense 171 538 3 8
ENSDART00000147885 Nonsense 135 261 3 4
Genomic Location (Zv9):
Chromosome 2 (position 23431395)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24777100
GRCz11 2 24432751
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTGTTCATGGTGGACAATGGTGCGGATGACTGGAGGATAGCCATGACATA[C/A]GAGCGCATCTTTTTCATTGTCCTGGAGCTGTTGGTGTGTGCCATTCACCC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link