adra2da

Ensembl ID:
ENSDARG00000091277
ZFIN ID:
ZDB-GENE-021010-4
Description:
Alpha-2Da adrenergic receptor [Source:UniProtKB/Swiss-Prot;Acc:Q8JG70]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa28225 Nonsense Mutation detected in F1 DNA During 2018
sa45506 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa28225
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123912 Nonsense 47 408 1 1
Genomic Location (Zv9):
Chromosome 14 (position 789649)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 772252
GRCz11 14 790516
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGCGATCATCATCCTCGTGGTGTCCCTCATCATCTTGCTCACCATCGTC[G/T]GAAATGTTCTGGTGATCGTGGCGGTTCTGACCAGCCGCGCGCTGCGCGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45506
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123912 Nonsense 295 408 1 1
Genomic Location (Zv9):
Chromosome 14 (position 790393)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 772996
GRCz11 14 791260
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTCGCGCTTCTCCAAGCGGCGGCGGGTTGAGGGCGAGCGCCGCGGCCCG[C/T]AGAGGAGCTGCCGGGTGTCCTGGGCTGCCCATCAGGAGCCCGGCAGCAGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link