ucp3

Ensembl ID:
ENSDARG00000091209
ZFIN ID:
ZDB-GENE-040426-1317
Description:
uncoupling protein 3 [Source:RefSeq peptide;Acc:NP_956647]
Human Orthologue:
UCP3
Human Description:
uncoupling protein 3 (mitochondrial, proton carrier) [Source:HGNC Symbol;Acc:12519]
Mouse Orthologue:
Ucp3
Mouse Description:
uncoupling protein 3 (mitochondrial, proton carrier) Gene [Source:MGI Symbol;Acc:MGI:1099787]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41711 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41711
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000124432 Essential Splice Site 43 209 4 9
ENSDART00000126963 Essential Splice Site 43 309 4 8
ENSDART00000127012 Essential Splice Site 43 209 4 7
Genomic Location (Zv9):
Chromosome 10 (position 37895536)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 36707697
GRCz11 10 36651455
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AATCACATAACACCCACAAACATAAAATTTTATGTTTTTGATCTTATTTC[A/T]GATCCAGGGAGAGTCTGGAACAGCACCAGGATCAGCGGTGCTGAAATATC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link