WDR25

Ensembl ID:
ENSDARG00000091201
Description:
WD repeat domain 25 [Source:HGNC Symbol;Acc:21064]
Human Orthologue:
WDR25
Human Description:
WD repeat domain 25 [Source:HGNC Symbol;Acc:21064]
Mouse Orthologue:
Wdr25
Mouse Description:
WD repeat domain 25 Gene [Source:MGI Symbol;Acc:MGI:3045255]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32114 Nonsense Available for shipment Available now
sa17036 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32114
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128782 Nonsense 81 215 2 4
Genomic Location (Zv9):
Chromosome 17 (position 143362)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1452433
GRCz11 17 812451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACTGATGCCGTCAGTCGAGACTCAGCCGACCGAACACTCATCGTCT[G/A]GGACTTCCAGACCAACGCCAAACTCTCCAACCAGATCTTCCATGTAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17036
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128782 Nonsense 173 215 4 4
Genomic Location (Zv9):
Chromosome 17 (position 142222)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 1451293
GRCz11 17 811311
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AGTGTCGTGGCCTCTGGGAGCTCCACCGGTTCTGTCCACTTCTATGACTA[T/A]CAGAGCTCGAGGACACKGAAGACACTACAGGCTCATGAGSATGCGTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link