
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
MKI67
- Ensembl ID:
- ENSDARG00000091150
- Description:
- antigen identified by monoclonal antibody Ki-67 [Source:HGNC Symbol;Acc:7107]
- Human Orthologue:
- MKI67
- Human Description:
- antigen identified by monoclonal antibody Ki-67 [Source:HGNC Symbol;Acc:7107]
- Mouse Orthologue:
- Mki67
- Mouse Description:
- antigen identified by monoclonal antibody Ki 67 Gene [Source:MGI Symbol;Acc:MGI:106035]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa31859 | Nonsense | Available for shipment | Available now |
sa12798 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa31859
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126369 | Nonsense | 1331 | 2057 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11450106)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10333177 GRCz11 12 10371020 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCAGAAAATCAGCTCGTGGTAGAATTACTAAGCAAAATGATGAAGACCAA[C/T]AAGAAAAGAACATTGAGGCTAGCCAAGTGCCAGCAGATTCCATGAAAATT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa12798
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000126369 | Nonsense | 1786 | 2057 | 14 | 15 |
- Genomic Location (Zv9):
- Chromosome 12 (position 11448741)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 12 10331812 GRCz11 12 10369655 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GACGAAGAGCAAAAGAACCYGAAACAAAGAAAGAAGAAAGTCCCTTRATA[C/T]AGACTAGTTCTGAAATTAATGCAGCAGTTTTGCCACTTGATAAGGTGGAA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Select biomarker traits: Genome-wide association with select biomarker traits in the Framingham Heart Study. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: