zgc:165628

Ensembl ID:
ENSDARG00000091122
ZFIN ID:
ZDB-GENE-070620-22
Description:
hypothetical protein LOC100093707 [Source:RefSeq peptide;Acc:NP_001092730]
Human Orthologue:
BCL11B
Human Description:
B-cell CLL/lymphoma 11B (zinc finger protein) [Source:HGNC Symbol;Acc:13222]
Mouse Orthologue:
Bcl11b
Mouse Description:
B-cell leukemia/lymphoma 11B Gene [Source:MGI Symbol;Acc:MGI:1929913]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa23039 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa23039
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000123745 Essential Splice Site 20 208 1 2
Genomic Location (Zv9):
Chromosome 17 (position 17948361)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 18098372
GRCz11 17 18118208
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCAAGCAGGGAAACCCTCAGCATTTGTCGCAAAGAGAAATTATAACACG[T/G]AAGTCTGTCTTTATGTTTTACTTATTTGTGTATTAAGAGGACGTTTGACC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Aortic stiffness: Common genetic variation in the 3'-BCL11B gene desert is associated with carotid-femoral pulse wave velocity and excess cardiovascular disease risk: the AortaGen Consortium. (View Study)
  • Corneal curvature: Genetic variants near PDGFRA are associated with corneal curvature in Australians. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link