
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
ENSDARG00000091100
- Ensembl ID:
- ENSDARG00000091100
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa17702 | Nonsense | Available for shipment | Available now |
sa21865 | Nonsense | Available for shipment | Available now |
sa5838 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa17702
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127595 | Nonsense | 120 | 404 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 12979696)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 12864105 GRCz11 11 12921764 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GCAAGATTTGKACWATCTCATGGCCGARAGTCRAGAAAGGCTRAGWGTTT[T/A]GAGGCTACAGAYGGAGTCRGAGCGGGAAAGACTAGATGAACTGGAGAGAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21865
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127595 | Nonsense | 137 | 404 | 2 | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 12979746)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 12864155 GRCz11 11 12921814 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAGGCTACAGATGGAGTCAGAGCGGGAAAGACTAGATGAACTGGAGAGA[C/T]AGCAGGAGCTCAACAAACAAGACATGGAGTTGCTGAAGGCCCAACTCAGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa5838
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000127595 | Essential Splice Site | 351 | 404 | 4 | 5 |
- Genomic Location (Zv9):
- Chromosome 11 (position 12983368)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 11 12867777 GRCz11 11 12925436 - KASP Assay ID:
- 554-3860.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTCTGATGATCCAGAGTTACTTGATAAACTGAATCATGGAGCGAAAGAAG[G/A]TCAGTCTTTTGCAAAGTCTTCCTCACTTTGATCTTCAGATTMTTTTTTAA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: