ENSDARG00000091094

Ensembl ID:
ENSDARG00000091094
Human Orthologues:
MUC12, MUC16, MUC17, MUC20, MUC4, MUC5B
Human Descriptions:
mucin 12, cell surface associated [Source:HGNC Symbol;Acc:7510]
mucin 16, cell surface associated [Source:HGNC Symbol;Acc:15582]
mucin 17, cell surface associated [Source:HGNC Symbol;Acc:16800]
mucin 20, cell surface associated [Source:HGNC Symbol;Acc:23282]
mucin 4, cell surface associated [Source:HGNC Symbol;Acc:7514]
mucin 5B, oligomeric mucus/gel-forming [Source:HGNC Symbol;Acc:7516]
Mouse Orthologues:
Muc20, Muc4
Mouse Descriptions:
mucin 20 Gene [Source:MGI Symbol;Acc:MGI:2385039]
mucin 4 Gene [Source:MGI Symbol;Acc:MGI:2153525]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa45859 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45859
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000129152 Nonsense 753 923 17 17
Genomic Location (Zv9):
Chromosome Zv9_NA113 (position 534)
Other Location(s):
Assembly Chromosome Position
GRCz10 KN149724.1 534
GRCz11 KN149724.1 534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGGTACACCAAACAGTATAACATCTACACCAATAAGTATGACAGTACAA[C/T]AGACAGCAACCCCACCAGACAGTACAACTGGTACGGCAAACAATGTAGCA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link