zcchc10

Ensembl ID:
ENSDARG00000091092
ZFIN IDs:
ZDB-GENE-030131-6172, ZDB-GENE-030131-6172
Description:
zinc finger CCHC domain-containing protein 10 [Source:RefSeq peptide;Acc:NP_001082808]
Human Orthologue:
ZCCHC10
Human Description:
zinc finger, CCHC domain containing 10 [Source:HGNC Symbol;Acc:25954]
Mouse Orthologue:
Zcchc10
Mouse Description:
zinc finger, CCHC domain containing 10 Gene [Source:MGI Symbol;Acc:MGI:1196228]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa39349 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa39349
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115192 Nonsense 26 156 2 5
ENSDART00000121725 Nonsense 26 156 2 4
Genomic Location (Zv9):
Chromosome 21 (position 41578577)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 43177623
GRCz11 21 43172799
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTCATACAGGGAGGCAAATAAGCAGCATGTTCGATGTCAGAAGTG[T/A]CTGGAATTTGGACACTGGTCTTATGAGTGTACTGGGAAGAGGAAGTATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link