si:ch211-124n19.5

Ensembl ID:
ENSDARG00000091023
ZFIN ID:
ZDB-GENE-081104-106
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:B0UX53]
Human Orthologue:
ANKRD57
Human Description:
ankyrin repeat domain 57 [Source:HGNC Symbol;Acc:26149]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45383 Nonsense Mutation detected in F1 DNA During 2018
sa21619 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa45383
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122832 Nonsense 77 468 1 7
ENSDART00000134699 Nonsense 98 206 1 2
Genomic Location (Zv9):
Chromosome 9 (position 57450626)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56440448
GRCz11 9 55790110
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGAAGCAGGAGAACGGAGAGAAGGTGGTGTGTTTGAAGAAGAAGTAC[C/T]GATTCCCGGAGGCGCGCAGCGGAGATGGCGATCAAGAAGATGATGATGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21619
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000122832 Nonsense 113 468 1 7
ENSDART00000134699 Nonsense 134 206 1 2
Genomic Location (Zv9):
Chromosome 9 (position 57450518)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 56440340
GRCz11 9 55790002
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAGAGGAAGATGGAGATACAAATGAAGATAAAGATGGAGAAATGATGTGT[A/T]AAGATAAAGAGGAGATTAACAGAGCAGTCAGCGACCTCCAGCTCCAGGAG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link