Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
im:7142942
- Ensembl ID:
- ENSDARG00000090993
- ZFIN ID:
- ZDB-GENE-041008-246
- Human Orthologue:
- RNF4
- Human Description:
- ring finger protein 4 [Source:HGNC Symbol;Acc:10067]
- Mouse Orthologue:
- Rnf4
- Mouse Description:
- ring finger protein 4 Gene [Source:MGI Symbol;Acc:MGI:1201691]
Alleles
There is 1 allele of this gene:
| Allele name | Consequence | Status | Availability Estimate |
|---|---|---|---|
| sa35660 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa35660
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
| Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
|---|---|---|---|---|---|
| ENSDART00000123145 | Nonsense | 11 | 184 | 2 | 7 |
- Genomic Location (Zv9):
- Chromosome 14 (position 15408013)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 14 17269999 GRCz11 14 17575652 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGAGATTGTAAGCCTTCGTGTTTCTGCTTTTTAGACCCAGAGAAAAAGA[C/T]GAACATCCACTACATGTTCACGCCGTGGCAACAGCAAGAGGAACCGGGCC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:
