SLC44A1 (1 of 3)

Ensembl ID:
ENSDARG00000090982
Description:
solute carrier family 44, member 1 [Source:HGNC Symbol;Acc:18798]
Human Orthologue:
SLC44A1
Human Description:
solute carrier family 44, member 1 [Source:HGNC Symbol;Acc:18798]
Mouse Orthologue:
Slc44a1
Mouse Description:
solute carrier family 44, member 1 Gene [Source:MGI Symbol;Acc:MGI:2140592]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35631 Essential Splice Site Available for shipment Available now
sa38978 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa35631
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121552 Essential Splice Site 35 282 1 7
Genomic Location (Zv9):
Chromosome 14 (position 6371237)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6058234
GRCz11 14 6365068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTCAGCAGATGACCGTCGCCGGAGCTGTGGTGACCTACTATTTCACAAG[G/T]TCGGTGTTTCTAGAGGAAAACTCTCATATGCTACTGGTCAACCTTTATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000121552 Essential Splice Site 240 282 5 7
Genomic Location (Zv9):
Chromosome 14 (position 6361499)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 6048496
GRCz11 14 6355330
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACAACAACGGCACACCTGGAAGAGAGTTCTACATGGACAAGGCCCTGATG[G/A]TGAGTCACAGACGGAGAAAAGCTCGCAATCTGTCTGAAAAACGCCATAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link