zgc:153234

Ensembl ID:
ENSDARG00000090962
ZFIN ID:
ZDB-GENE-060825-15
Description:
N-acetyltransferase 14 [Source:UniProtKB/Swiss-Prot;Acc:Q0P4A4]
Human Orthologue:
NAT14
Human Description:
N-acetyltransferase 14 (GCN5-related, putative) [Source:HGNC Symbol;Acc:28918]
Mouse Orthologue:
Nat14
Mouse Description:
N-acetyltransferase 14 Gene [Source:MGI Symbol;Acc:MGI:3039561]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa22775 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa22775
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000128497 Nonsense 127 280 3 3
Genomic Location (Zv9):
Chromosome 16 (position 14386291)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 12744856
GRCz11 16 12636588
KASP Assay ID:
2260-9334.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACCAGATTTACCCAATCCTCACCTGGGCAGAGCCAAGCTGACTACCAAC[C/T]AGGAGAAAACCAGACGGCGCAAAAAGGCCAAAGAGAAGGAGAAGATGAAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link